Sequence ID | >WENV170652680 |
Genome ID | JRYH01013943 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 573 |
End posion on genome | 649 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcgccgccgt |
tRNA gene sequence |
CGGAGTGTAGCTCAGCCTGGTAGAGCACCGTGTTCGGGACGCGGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
tttctcccgc |
Secondary structure (Cloverleaf model) | >WENV170652680 Pro CGG t ACCA tttctcccgc C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G C - G G - C T + G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |