Sequence ID | >WENV170652681 |
Genome ID | JRYH01014100 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8692 |
End posion on genome | 8614 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aataaaataa |
tRNA gene sequence |
GCCTCTATGCTGCACGTTGGAATGCAGAGTGGTCTTAGAAACCATTGTTTCGTAGGTTCG |
Downstream region at tRNA end position |
tatgcaatca |
Secondary structure (Cloverleaf model) | >WENV170652681 Leu TAG a ACTA tatgcaatca G + T C - G C - G T - A C - G T - A A - T T T T C A T C C A T G C A G | | | | | G T C G T C G T A G G C G | | | | T T G G C A G A A T A TGTTTC G + T T - A G - C G - C T - A C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |