Sequence ID | >WENV170652684 |
Genome ID | JRYH01014701 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 431 |
End posion on genome | 507 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cctacaattt |
tRNA gene sequence |
CTCTCTGTAGCTCAATCGGATAGAGCAATTGCCTTCTAAGTAATAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
acccccgatg |
Secondary structure (Cloverleaf model) | >WENV170652684 Arg TCT t ACCA acccccgatg C - G T - A C - G T - A C - G T - A G - C T A T C T C C C A T A A A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTC A - T T - A T - A G + T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |