Sequence ID | >WENV170652685 |
Genome ID | JRYH01014701 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1756 |
End posion on genome | 1830 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
taaattagaa |
tRNA gene sequence |
GCGGTCATAGTTCAGTGGTAGAACATTTGCCTTCCAAGCAAAGTGTCGCCGGTTCGATCC |
Downstream region at tRNA end position |
ttaatgaaag |
Secondary structure (Cloverleaf model) | >WENV170652685 Gly TCC a TCCA ttaatgaaag G - C C - G G - C G - C T + G C - G A - T C T T C G G C C A G A A | | | | | G T C T T G G C C G G C G | | | | T T G G A A C T A A GTGTC T - A T - A T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |