Sequence ID | >WENV170652686 |
Genome ID | JRYH01014810 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1184 |
End posion on genome | 1097 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gaccgcagcg |
tRNA gene sequence |
GCCCACGTGGCGGAATTGGTAGACGCAAGGGACTTAAAATCCCTCGCCTGTTTCAGGCGT |
Downstream region at tRNA end position |
gcgcctcatc |
Secondary structure (Cloverleaf model) | >WENV170652686 Leu TAA g ACCA gcgcctcatc G - C C - G C - G C - G A - T C - G G - C C T T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G A CGCCTGTTTCAGGCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |