Sequence ID | >WENV170652688 |
Genome ID | JRYH01014994 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4910 |
End posion on genome | 4985 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtcgggctct |
tRNA gene sequence |
TCCCCGATAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGTCCCTGGTTCGAGC |
Downstream region at tRNA end position |
gatcaagggt |
Secondary structure (Cloverleaf model) | >WENV170652688 Asn GTT t GCCA gatcaagggt T - A C - G C - G C - G C - G G - C A - T C G T G G A C C A T G A A | | | | | G C C T C G C C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |