Sequence ID | >WENV170652690 |
Genome ID | JRYH01015138 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5394 |
End posion on genome | 5469 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcacggcaac |
tRNA gene sequence |
GCCTCCGTAGCTCAGTGGATAGAGCATCTCCCTCCTAAGGAGAGGGTCGCACGTTCGATT |
Downstream region at tRNA end position |
ataaaaatca |
Secondary structure (Cloverleaf model) | >WENV170652690 Arg CCT c GCCA ataaaaatca G - C C - G C - G T + G C - G C - G G - C T T T C G T G C A T G A A | | | | | G G C T C G G C A C G C G | | | | T T A G A G C T A A GGGTC T - A C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |