Sequence ID | >WENV170652691 |
Genome ID | JRYH01015561 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6767 |
End posion on genome | 6691 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cggcttgtgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGCGAGTTCGAA |
Downstream region at tRNA end position |
atcaaacaaa |
Secondary structure (Cloverleaf model) | >WENV170652691 Pro GGG t ACCA atcaaacaaa C - G G - C G - C G - C G - C C - G G - C T A T C G C C C A C G A A | | | | G C C G C G G C G A G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |