Sequence ID | >WENV170652693 |
Genome ID | JRYH01015665 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3375 |
End posion on genome | 3300 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggttttagtg |
tRNA gene sequence |
GCGGCATTAGCTCAGTTGGTAGAGCACTGGATTGTGGCTCCAGGTGTCACCGGTTCGATC |
Downstream region at tRNA end position |
agtatttaaa |
Secondary structure (Cloverleaf model) | >WENV170652693 His GTG g CCCA agtatttaaa G - C C - G G - C G + T C - G A - T T - A C T T T G G C C A T G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |