Sequence ID | >WENV170652696 |
Genome ID | JRYH01016191 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3816 |
End posion on genome | 3732 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gcgcgcccct |
tRNA gene sequence |
GCCCGGGTGGCGAAATTGGTAACCGCAGCGGACTTAAAATCCGCCGTCGCATGGCTTACG |
Downstream region at tRNA end position |
acggcgagca |
Secondary structure (Cloverleaf model) | >WENV170652696 Leu TAA t ACCA acggcgagca G - C C - G C - G C - G G - C G - C G - C T G T T G C C C A T A A G | | | | | G T A G C G A C G G G C G | | | T T G C C G C T A A A CGTCGCATGGCTT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |