Sequence ID | >WENV170652698 |
Genome ID | JRYH01016251 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 809 |
End posion on genome | 905 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
ccgctccgat |
tRNA gene sequence |
GGAAGAGAGGCGTTCCCCGGTGGGGCGACTGGTCTTCAAAACCAGGTGGGGCCGCCAGCC |
Downstream region at tRNA end position |
tacctcttct |
Secondary structure (Cloverleaf model) | >WENV170652698 SeC(p) TCA t GCCA tacctcttct G - C G - C A - T A - T G - C A - T G - C A - T T C G T A C C C A C C C G + | | | | G C T T G C G T G G G C G + + | | T T G G G C G T G G A GTGGGGCCGCCAGCCGGTCCCAG C - G T - A G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |