Sequence ID | >WENV170652699 |
Genome ID | JRYH01016345 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1484 |
End posion on genome | 1559 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
atttcttcac |
tRNA gene sequence |
GCGCCCATAGCTCAGTGGATAGAGTACCGCCCTCCGAAGGCGGGGGTCGCACGTTCGAAT |
Downstream region at tRNA end position |
ttgattgata |
Secondary structure (Cloverleaf model) | >WENV170652699 Arg CCG c GCCA ttgattgata G - C C - G G - C C - G C - G C - G A - T T A T C G T G C A T G A A | | | | | G G C T C G G C A C G C G | | | + T T A G A G T T A A GGGTC C - G C - G G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |