Sequence ID | >WENV170652700 |
Genome ID | JRYH01016410 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1636 |
End posion on genome | 1712 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctcccaggcg |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGTCCTGGATGTCGTCGGTTCGAA |
Downstream region at tRNA end position |
atttccccgc |
Secondary structure (Cloverleaf model) | >WENV170652700 His GTG g CCCA atttccccgc G - C C - G G - C G + T G - C T - A G - C T A T T A G C C A T G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C T T A G ATGTC C - G C - G A - T G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |