Sequence ID | >WENV170652710 |
Genome ID | JRYH01017586 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1210 |
End posion on genome | 1299 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tccgcaccac |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGACGAAGGCGCTGGTCTCGAAAACCAGTAGAGTCGTAAGGCTC |
Downstream region at tRNA end position |
gccaggaaac |
Secondary structure (Cloverleaf model) | >WENV170652710 Ser CGA c GCCA gccaggaaac G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | A G G C C G G T G G G C G | | | T T A A G G C C G A G TAGAGTCGTAAGGCTCTC C - G T - A G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |