Sequence ID | >WENV170652712 |
Genome ID | JRYH01018005 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 637 |
End posion on genome | 561 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcaccatcat |
tRNA gene sequence |
CGGGGTGTAGCTTAGCCTGGTAGAGCGCTACGTTCGGGACGTAGAGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
gcattccctc |
Secondary structure (Cloverleaf model) | >WENV170652712 Pro CGG t ACCA gcattccctc C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A C G A A + | | | | G C T T C G G G A G G C T + | | | T T G G A G C G T A G AGGCC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |