Sequence ID | >WENV170652713 |
Genome ID | JRYH01018132 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 120 |
End posion on genome | 44 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gccttgaaac |
tRNA gene sequence |
GGTTCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGTCGCACGTTCAAA |
Downstream region at tRNA end position |
gatttcttca |
Secondary structure (Cloverleaf model) | >WENV170652713 Arg CCG c GCCA gatttcttca G - C G + T T T T + G C - G C - G G - C T A T C G T G C A C G A A | | | | | A T C T C G G C A C G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |