Sequence ID | >WENV170652714 |
Genome ID | JRYH01018277 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 761 |
End posion on genome | 675 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctgcccgtag |
tRNA gene sequence |
GCGGCCGTGGCGGAATTGGTAGACGCACCAGGTTTAGGTCCTGGCGCCTTCGCTGGCGTG |
Downstream region at tRNA end position |
ccgttgttcg |
Secondary structure (Cloverleaf model) | >WENV170652714 Leu TAG g ACCA ccgttgttcg G - C C - G G - C G - C C - G C - G G - C T G T T T T C C A T A A G + | | | | G T G G C G G A A G G C G | | | T T G A C G C T A G A CGCCTTCGCTGGCGT C - G C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |