Sequence ID | >WENV170652717 |
Genome ID | JRYH01018543 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 120 |
End posion on genome | 33 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccggacggac |
tRNA gene sequence |
GGATGAGTGGCGGAGTGGTTGAATGCTCTTGTCTTGAAAACCAGCGATCCTAAAGGTTCC |
Downstream region at tRNA end position |
ccacataagt |
Secondary structure (Cloverleaf model) | >WENV170652717 Ser TGA c GCCT ccacataagt G - C G - C A - T T - A G - C A - T G - C T A T C A C A C A T G A G | | | | G G G G C G G T G G G C G + | | T T T A T G C T G A T CGATCCTAAAGGTTCC C - G T - A T C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |