Sequence ID | >WENV170652719 |
Genome ID | JRYH01018619 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1941 |
End posion on genome | 1867 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctaaaatcc |
tRNA gene sequence |
GGCGACGTAGCTCAGAGGCAGAGCAGGGCTCTCATAAGGCCCGTGTCGGTGGTTCGATTC |
Downstream region at tRNA end position |
tacccaaccc |
Secondary structure (Cloverleaf model) | >WENV170652719 Met CAT c ACCA tacccaaccc G - C G - C C - G G - C A - T C - G G - C T T T C C A C C A G A A | | | | | G A C T C G G G T G G C G | | | | T T G G A G C C A A GTGTC G - C G - C G - C C - G T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |