Sequence ID | >WENV170652720 |
Genome ID | JRYH01018726 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3979 |
End posion on genome | 4054 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cggaaggtgc |
tRNA gene sequence |
GGCCCCGTAGCTCAGGGGATAGAGCGACCGCCTCCTAAGCGGTAGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
tcgtccaatt |
Secondary structure (Cloverleaf model) | >WENV170652720 Arg CCT c GCCA tcgtccaatt G - C G - C C - G C - G C - G C - G G - C T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A G AGGTC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |