Sequence ID | >WENV170652721 |
Genome ID | JRYH01018802 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 36 |
End posion on genome | 112 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ccgacatccc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGGACGTTCGAA |
Downstream region at tRNA end position |
aagaattcaa |
Secondary structure (Cloverleaf model) | >WENV170652721 Arg CCG c GCCA aagaattcaa G - C C - G G - C C - G C - G C - G G - C T A T T C T G C A C G A A + | | | | G T C T C G G G A C G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |