Sequence ID | >WENV170652724 |
Genome ID | JRYH01019079 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4591 |
End posion on genome | 4675 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gggccatgat |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCACTACCTTGAGGTGGTAGCGGGGCAACCCGTGGA |
Downstream region at tRNA end position |
aattgactga |
Secondary structure (Cloverleaf model) | >WENV170652724 Leu GAG t ACCA aattgactga G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G A CGGGGCAACCCGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |