Sequence ID | >WENV170652732 |
Genome ID | JRYH01020363 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 272 |
End posion on genome | 198 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcccgcctgg |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTGAGAGCGCAGGATTCATAACCCTGAGGTCACGGGTTCAAC |
Downstream region at tRNA end position |
attaaattac |
Secondary structure (Cloverleaf model) | >WENV170652732 Met CAT g TCag attaaattac G + T G - C C - G G - C G + T G + T G - C T C T T G C C C A T G A A | | | | | A T C T C G A C G G G C G | | | | T T G G A G C T G A G AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |