Sequence ID | >WENV170652733 |
Genome ID | JRYH01020427 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 712 |
End posion on genome | 637 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gctactatat |
tRNA gene sequence |
AGGGCAGAAGTGTTGTTGGTAACATGGTCGACTGTCTCTCGACTGATTGTGGGTTCGACT |
Downstream region at tRNA end position |
ctaattagtg |
Secondary structure (Cloverleaf model) | >WENV170652733 Asp GTC t GCAA ctaattagtg A - T G - C G - C G - C C - G A - T G G T C A T A C C C A T G T A + | | | | G T T G T G G T G G G C G | | | + T T G A C A T T A G TGATT G - C T - A C - G G - C A - T C C T T G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |