Sequence ID | >WENV170652735 |
Genome ID | JRYH01020428 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1277 |
End posion on genome | 1201 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
taacttaaac |
tRNA gene sequence |
AGACAGGTAGAACAATTGGTCAGTTCGCCACCCTGATAAGGTGGAGGTTATTGGTTCGAG |
Downstream region at tRNA end position |
acttaaagaa |
Secondary structure (Cloverleaf model) | >WENV170652735 Ile GAT c ACAA acttaaagaa A - T G - C A - T C - G A - T G + T G - C T G T T A A C C A T A A A | | | | | G T C A A G A T T G G C G | | | | T T G G T T C T C A G AGGTT C - G C - G A - T C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |