Sequence ID | >WENV170652736 |
Genome ID | JRYH01020428 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 235 |
End posion on genome | 161 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctgtacattt |
tRNA gene sequence |
GCGAGTATCGTATAGGGGTTAGTATGTCTGGTTTCCACCCAGAAGGCGAGAGTTCGATTC |
Downstream region at tRNA end position |
tattaaggtt |
Secondary structure (Cloverleaf model) | >WENV170652736 Gly TCC t TCAA tattaaggtt G - C C - G G - C A - T G + T T - A A - T T T T C T C T C A G G A C | | | | | G G T A T G G A G A G C G + | | + T T T G T A T T A G AGGC T - A C - G T - A G - C G - C T C T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |