Sequence ID | >WENV170652737 |
Genome ID | JRYH01020552 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1409 |
End posion on genome | 1484 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcaaggcaac |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCAGTTGACTCTTAATCAATTGGTCCTAGGTTCGAGT |
Downstream region at tRNA end position |
aataattcaa |
Secondary structure (Cloverleaf model) | >WENV170652737 Lys CTT c ACCA aataattcaa G - C G - C G - C G - C G - C T + G A - T T G T G A T C C A T G A A | | | | | G T C T C G C T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |