Sequence ID | >WENV170652738 |
Genome ID | JRYH01020629 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2202 |
End posion on genome | 2128 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agcagcgcat |
tRNA gene sequence |
TGGGGCGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCCATGCGGAGGTTCGAATC |
Downstream region at tRNA end position |
gaccttttcg |
Secondary structure (Cloverleaf model) | >WENV170652738 Gln TTG t GCCA gaccttttcg T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A A | | | | | G C A C C G G G A G G C G | | | T T G A G G C T A A CATGC G - C C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |