Sequence ID | >WENV170652740 |
Genome ID | JRYH01021030 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2964 |
End posion on genome | 2891 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgaaagatta |
tRNA gene sequence |
GCAGGCTTAGTTTAAAGGCAAAACACTTGGCTTCCATCCATGAGTTACTGGTTCGAGTCC |
Downstream region at tRNA end position |
cagcatgaaa |
Secondary structure (Cloverleaf model) | >WENV170652740 Gly TCC a TCCA cagcatgaaa G - C C - G A - T G - C G + T C - G T - A T G T T G G C C A A A A | | + | | G A T T T G A C T G G C G | | | | T T G A A A C C A A AGTT C - G T T T - A G - C G - C C T T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |