Sequence ID | >WENV170652741 |
Genome ID | JRYH01021418 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 648 |
End posion on genome | 564 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttccagtaa |
tRNA gene sequence |
GGGCAGGTGGCGGAATCGGCAGACGCGACGGCCTCAAAAGTCGTTGGGCTTACGCTCGTG |
Downstream region at tRNA end position |
taagaatagt |
Secondary structure (Cloverleaf model) | >WENV170652741 Leu CAA a ACtc taagaatagt G - C G - C G - C C - G A - T G - C G - C T C T C T C C C A T A A G | | | | | G C G G C G G A G G G C G | | | T T G A C G C C A G G TGGGCTTACGCTCGT A - T C - G G - C G + T C - G C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |