Sequence ID | >WENV170652742 |
Genome ID | JRYH01021495 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 255 |
End posion on genome | 181 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgcgcaacaa |
tRNA gene sequence |
GGTACTGTAGCCAACTGGTAAGGCAACTGTCTGCAAAATAGTTATATGTGAGTTCGATTC |
Downstream region at tRNA end position |
cttatttgac |
Secondary structure (Cloverleaf model) | >WENV170652742 Cys GCA a TCAA cttatttgac G - C G - C T - A A - T C - G T - A G - C T T T C A C T C A C A A | | | | | G T A C C G G T G A G C G | | | T T G A G G C T A A TATAT A - T C - G T - A G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |