Sequence ID | >WENV170652743 |
Genome ID | JRYH01021547 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12 |
End posion on genome | 101 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gctgaaaaaa |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGATCGCGCCGCACTCGAAATGCGGAGTACGGGCAACCGTA |
Downstream region at tRNA end position |
tatcttattg |
Secondary structure (Cloverleaf model) | >WENV170652743 Ser CGA a GCCA tatcttattg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G + | | T T T T C G C C G A G AGTACGGGCAACCGTACC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |