Sequence ID | >WENV170652747 |
Genome ID | JRYH01021780 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 801 |
End posion on genome | 727 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
gttactcggc |
Secondary structure (Cloverleaf model) | >WENV170652747 Gly GCC n TCCA gttactcggc G - C C - G G - C G - C G - C T + G G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |