Sequence ID | >WENV170652749 |
Genome ID | JRYH01022103 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6118 |
End posion on genome | 6194 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gtttcacaat |
tRNA gene sequence |
GCGGGGTTAGTTCAGTTGGTAGAATTTTCTGATTTCCAATCAGGTGGTCGTCGGTTCGAG |
Downstream region at tRNA end position |
taagatttac |
Secondary structure (Cloverleaf model) | >WENV170652749 Gly TCC t TCCA taagatttac G - C C - G G - C G - C G + T G - C T - A T G T C A G C C A T G A A | | | | | G T C T T G G T C G G C G | + T T G A A T T T A G T TGGTC T + G C - G T - A G - C A - T T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |