Sequence ID | >WENV170652751 |
Genome ID | JRYH01022103 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6671 |
End posion on genome | 6755 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caccagtaat |
tRNA gene sequence |
GCGGGTATGGTGGAATTGGTAGTCACAACAGACTCAAAATCTGTCGCCATAAGGCGTAAG |
Downstream region at tRNA end position |
gatttatagt |
Secondary structure (Cloverleaf model) | >WENV170652751 Leu CAA t ACCA gatttatagt G + T C - G G - C G - C G - C T - A A - T T G T T T C C C A T A A G | | | | | G T G G T G A A G G G C G + | | | T T G T C A C T A G A CGCCATAAGGCGT A - T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |