Sequence ID | >WENV170652754 |
Genome ID | JRYH01022563 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1359 |
End posion on genome | 1285 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
nnnnnncgat |
tRNA gene sequence |
TGGGGCGTAGCCAAGTGGTAAGGCAGCGGATTTTGATTCCGCCATGCGGAGGTTCGAACC |
Downstream region at tRNA end position |
attgtttcaa |
Secondary structure (Cloverleaf model) | >WENV170652754 Gln TTG t GCCA attgtttcaa T - A G - C G - C G - C G - C C - G G - C C A T C C T C C A G A A | | | | | G T A C C G G G A G G C G | | | T T G A G G C T A A CATGC G - C C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |