Sequence ID | >WENV170652755 |
Genome ID | JRYH01022674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1849 |
End posion on genome | 1773 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggctacaact |
tRNA gene sequence |
GCTCTCATAACTCAGATGGCTAGAGTACTAAACTTTTAATTTAGGAGTCCCAGGTTCGAT |
Downstream region at tRNA end position |
taaaatatat |
Secondary structure (Cloverleaf model) | >WENV170652755 Lys TTT t ACAA taaaatatat G - C C - G T - A C - G T + G C - G A - T C T T G G T C C A A G A A | | | | | G T C T C A C C A G G C G | | | | T T G G A G T C T A A GAGTC C - G T - A A - T A - T A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |