Sequence ID | >WENV170652756 |
Genome ID | JRYH01022674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1623 |
End posion on genome | 1549 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gaagaactat |
tRNA gene sequence |
GCTCCTGTCGTCTAGTTGGTCTAGGACACTACTCTTTCACAGTAGAAACGTGGGTTCAAA |
Downstream region at tRNA end position |
ttttaatttg |
Secondary structure (Cloverleaf model) | >WENV170652756 Glu TTC t ACtt ttttaatttg G - C C A T - A C - G C - G T - A G - C T A T T A C C C A T T G A C + | | | | A G T C T G G T G G G C G + | | | T T T G G A C C T A A AAAC C - G T - A A - T C - G T - A C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |