Sequence ID | >WENV170652757 |
Genome ID | JRYH01022674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1071 |
End posion on genome | 996 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
acaataatta |
tRNA gene sequence |
GCTCTTGAAGCATTGATGGCGATGCAACTGTTTTGTAAACAGAAGATAGTAGGTTCGATT |
Downstream region at tRNA end position |
ttttgtccta |
Secondary structure (Cloverleaf model) | >WENV170652757 Thr TGT a TCTA ttttgtccta G - C C - G T - A C - G T + G T + G G - C T T A C A T C C A A G T A | | | | | G T T A C G G T A G G C G | | | | T T G A T G C C G A AGATA A A C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |