Sequence ID | >WENV170652759 |
Genome ID | JRYH01022674 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 919 |
End posion on genome | 845 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taggacaact |
tRNA gene sequence |
GTGTAGGTAGCTTAATAGGTAAAGCATTGGTTTGTGGCATCAAGGGATGCGGGTTCAATT |
Downstream region at tRNA end position |
tacattgaag |
Secondary structure (Cloverleaf model) | >WENV170652759 His GTG t CCAa tacattgaag G - C T - A G - C T - A A - T G - C G - C T T T T G C C C A T A A A + | | | | A A T T C G G C G G G C G | | | | T T G A A G C T A A GGGAT T - A T - A G - C G + T T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |