Sequence ID | >WENV170652762 |
Genome ID | JRYH01022943 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 85 |
End posion on genome | 10 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgccctttcc |
tRNA gene sequence |
GGGCCCGTAGCTCAATGGTTAGAGCTGGCGGCTCATAACCGCCTGGTTCCAGGTTCGAGT |
Downstream region at tRNA end position |
gttgcctttn |
Secondary structure (Cloverleaf model) | >WENV170652762 Met CAT c ACCA gttgcctttn G - C G - C G - C C - G C - G C - G G - C T G T G G T C C A T A A A | | | | | G G C T C G C C A G G C G | | | | T T T G A G C T A T TGGTT G - C G - C C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |