Sequence ID | >WENV170652763 |
Genome ID | JRYH01023034 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 351 |
End posion on genome | 440 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cacccggtgc |
tRNA gene sequence |
GGAGAGGTGCCAGAGAGGTCGATTGGGACGGTCTCGAAAACCGTTGTGCGGGCAACCGTA |
Downstream region at tRNA end position |
nngtggtaat |
Secondary structure (Cloverleaf model) | >WENV170652763 Ser CGA c GCCA nngtggtaat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A A G A G | | | | | G G G A C C G T G G G C G + | | | T T T T T G G C G A G TGTGCGGGCAACCGTACC A - T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |