Sequence ID | >WENV170652767 |
Genome ID | JRYH01023538 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3011 |
End posion on genome | 2927 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtcgtcacgg |
tRNA gene sequence |
GCCCCTGTGGTGGAATTGGTAGACACGCCTGACTCAAAATCAGGTGCTGCAAAGCGTGCT |
Downstream region at tRNA end position |
actttccctg |
Secondary structure (Cloverleaf model) | >WENV170652767 Leu CAA g ACCA actttccctg G - C C - G C - G C - G C - G T - A G - C T G T C G G C C A T A A G | | + | | G T G G T G G C T G G C G | | | T T G A C A C T A G G TGCTGCAAAGCGT C - G C - G T - A G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |