Sequence ID | >WENV170652770 |
Genome ID | JRYH01024723 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 953 |
End posion on genome | 877 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tcaggttttg |
tRNA gene sequence |
GGGTGTGTAGCTCAGGTGGTTAGAGCGTACGCCTGATAAGCGTAAGGTCGGAGGTTCGAG |
Downstream region at tRNA end position |
tttccctgtc |
Secondary structure (Cloverleaf model) | >WENV170652770 Ile GAT g ACCA tttccctgtc G - C G - C G - C T - A G - C T - A G - C T G T C C T C C A G G A A | | | | | G T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC T - A A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |