Sequence ID | >WENV170652771 |
Genome ID | JRYH01024844 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1002 |
End posion on genome | 1078 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aggtctacgg |
tRNA gene sequence |
GGCGGAGTAGCTCAGCTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ggtccctgtc |
Secondary structure (Cloverleaf model) | >WENV170652771 Met CAT g ACCA ggtccctgtc G + T G - C C - G G - C G - C A - T G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |