Sequence ID | >WENV170652780 |
Genome ID | JRYH01026723 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 361 |
End posion on genome | 273 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgagtagtgc |
tRNA gene sequence |
TTCGAAGTACCCGAGTTGGTAGCAGGGAACAGACTGTTAATCTGTAGGGTTAAAAGCCCC |
Downstream region at tRNA end position |
tactcatctg |
Secondary structure (Cloverleaf model) | >WENV170652780 Asn GTT c GCac tactcatctg T - A T - A C - G G - C A - T A - T G - C T G T C A A C C A T T G A A | | | | | G G G C C C G T T G G C G | | | T T T A G G G A G C A AGGGTTAAAAGCCCCGTC A - T C - G A - T G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |