Sequence ID | >WENV170652785 |
Genome ID | JRYH01027936 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1261 |
End posion on genome | 1345 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcgcctccct |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCACTAGTTTCAGGTACTAGCGCTGCGAGGCGTGGA |
Downstream region at tRNA end position |
gctgcaggga |
Secondary structure (Cloverleaf model) | >WENV170652785 Leu CAG t ACCA gctgcaggga G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGCTGCGAGGCGT C - G T - A A - T G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |