Sequence ID | >WENV170652788 |
Genome ID | JRYH01028009 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 64 |
End posion on genome | 155 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gatttacgcc |
tRNA gene sequence |
GGAGAGGTGACCGAGTGGCCGAAGGTGCACGCCTGGAAAGTGTGTAGGGGGTTAACGCTC |
Downstream region at tRNA end position |
tatatattcg |
Secondary structure (Cloverleaf model) | >WENV170652788 Ser GGA c GCCA tatatattcg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | A G G C C A G T G G G C G | | | T T C A G G T C G A G TAGGGGGTTAACGCTCCCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |