Sequence ID | >WENV170652791 |
Genome ID | JRYH01029489 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 279 |
End posion on genome | 355 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctacgcaga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
ataaacttga |
Secondary structure (Cloverleaf model) | >WENV170652791 Met CAT a ACCA ataaacttga C T G - C C - G G - C G - C G - C G - C T A T C C T C C A C G A G | | | | | A T C G A G G G A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |