Sequence ID | >WENV170652792 |
Genome ID | JRYH01029771 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 782 |
End posion on genome | 706 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
taagctgcaa |
tRNA gene sequence |
GCCCACGTAGGCCAACAGGTAGAGTCAGTCGACTTAAAATCGATAAAGTGTCAGTTCGAA |
Downstream region at tRNA end position |
aatttttcgg |
Secondary structure (Cloverleaf model) | >WENV170652792 Leu TAA a ACCA aatttttcgg G - C C - G C - G C - G A - T C - G G - C T A T C A G T C A C A A A | | | | | G A C C G G G T C A G C G | + | T T G A G T C T A G A AAAGT G + T T - A C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |